{{Rsnum
|rsid = 28360071
|Gene = XRCC4
|Orientation=plus
|geno1=(-;-)
|geno2=(-;GATGAGGAAACTAACTCTCAGTGGTGTTTA)
|geno3=(GATGAGGAAACTAACTCTCAGTGGTGTTTA;GATGAGGAAACTAACTCTCAGTGGTGTTTA)
|Chromosome=5
|position=83142293
|Assembly=GRCh38
|GenomeBuild=38.1
|dbSNPBuild=141
|Gene_s=XRCC4
}}[[rs28360071]] is an insertion/deletion SNP in the DNA repair [[XRCC4]] gene.

Individuals in a Taiwanese Chinese population heterozygous for this SNP [[rs28360071]] were at increased risk (odd ratio 1.57, CI: 1.12-2.21) of oral [[cancer]] compared to those homozygous for the insertion form of this SNP. The deletion allele was also associated with 3x higher risk than the insertion allele among smokers and betel quid chewer groups.{{PMID|18164646}}
{{PMID Auto
|PMID=19443403
|Title=Significant Association of an XRCC4 Single Nucleotide Polymorphism with Bladder Cancer Susceptibility in Taiwan
}}; note: no association seen for this SNP
{{PMID Auto
|PMID=19729825
|Title=Lung cancer susceptibility and genetic polymorphism of DNA repair gene XRCC4 in Taiwan
}}
{{PMID Auto
|PMID=20332465
|Title=Significant association of XRCC4 single nucleotide polymorphisms with childhood leukemia in Taiwan
}}
{{PMID Auto
|PMID=20683005
|Title=Colorectal Cancer and Genetic Polymorphism of DNA Double-strand Break Repair Gene XRCC4 in Taiwan
}}
{{PMID Auto
|PMID=21717429
|Title=Genetic variants of the nonhomologous end joining gene LIG4 and severe radiation pneumonitis in nonsmall cell lung cancer patients treated with definitive radiotherapy
|OA=1
}}{{PMID Auto
|PMID=17987338
|Title=A novel single nucleotide polymorphism in XRCC4 gene is associated with gastric cancer susceptibility in Taiwan.
}}

{{PMID Auto
|PMID=21506695
|Title=Do polymorphisms in XRCC4 influence prostate cancer susceptibility in North Indian population?
}}