{{Rsnum
|rsid=28363170
|geno1=(-;-)
|geno2=(-;ACTGGAGCGTGTACTACCCCAGGACGCATGCAGGGCCCCC)
|geno3=(ACTGGAGCGTGTACTACCCCAGGACGCATGCAGGGCCCCC;ACTGGAGCGTGTACTACCCCAGGACGCATGCAGGGCCCCC)
|Chromosome=5
|Orientation=minus
|Gene=SLC6A3
|position=1393747
|Assembly=GRCh38
|GenomeBuild=38.1
|dbSNPBuild=141
|Gene_s=SLC6A3
}}{{PMID Auto
|PMID=21525861
|Title=Dopamine Transporter Gene Variant Affecting Expression in Human Brain is Associated with Bipolar Disorder
|OA=1
}}
{{PMID Auto
|PMID=22067551
|Title=When control fails: Influence of the prefrontal but not striatal dopaminergic system on behavioural flexibility in a change detection task
}}{{PMID Auto
|PMID=17483451
|Title=Gene-gene interaction associated with neural reward sensitivity.
|OA=1
}}

{{PMID Auto
|PMID=18081710
|Title=Multivariate permutation analysis associates multiple polymorphisms with subphenotypes of major depression.
|OA=1
}}
{{PMID Auto
|PMID=23653272
|Title=Correlations between polymorphisms in genes coding elements of dopaminergic pathways and body mass index in overweight and obese women
}}{{PMID Auto
|PMID=23647133
|Title=The association of a novel haplotype in the dopamine transporter with preschool age posttraumatic stress disorder.
|OA=1
}}