{{Rsnum
|rsid=333
|Gene=CCR5
|Orientation=plus
|ReferenceAllele=GTCAGTATCAATTCTGGAAGAATTTCCAGACA
|geno1=(-;-)
|geno2=(-;GTCAGTATCAATTCTGGAAGAATTTCCAGACA)
|geno3=(GTCAGTATCAATTCTGGAAGAATTTCCAGACA;GTCAGTATCAATTCTGGAAGAATTTCCAGACA)
|Chromosome=3
|position=46373456
|Assembly=GRCh38
|GenomeBuild=38.1
|dbSNPBuild=141
|Gene_s=CCR5,LOC102724297
}}{{interesting}}

The chemokine receptor gene [[CCR5]] plays an important role in many immune-related processes. Delta 32 [[rs333]], designating the CCR5-delta32 deletion of 32 nucleotides from within the gene, is perhaps the most famous allele of [[CCR5]]. 23andMe tests for this by the name [[I3003626]].

Individuals carrying one copy of the delta 32 allele are somewhat resistant to infection by [[HIV]], the virus that causes [[AIDS]], and individuals with 2 copies (delta 32 homozygotes, ~1% of Caucasians) are almost completely immune to infection by HIV. {{PMID|8898752}} The delta 32 allele may have been selected for in European populations because it confers resistance to plague (Black Death) or smallpox. [http://www.pnas.org/content/100/25/15276.long]

[http://content.nejm.org/cgi/content/full/NEJMoa0807917 NEJM] suggests decreased risk of [[type 1 diabetes]] (odds ratio, 0.54; 95% CI, 0.40 to 0.72; P=1.88x10–6 with 2 df). 

Does the CCR5-delta32 mutation have an entirely positive/protective role?

Probably not. In patients with [[abdominal aortic aneurysm]] (AAA), the major risk is a sudden rupture - which is quite often fatal. Individuals with the delta 32 variant are more likely to have aneurysms than non-carriers, and among patients with aneurysms, delta 32 carriers are more likely to rupture than to be diagnosed in time for surgical repair. {{PMID|15557916}}

Tests for CCR-delta32 are offered by [http://www.familytreedna.com/advanced-test-results.aspx FamilyTreeDNA] ([http://www.familytreedna.com/faq/answers/default.aspx?faqid=8#518 FAQ]), [https://www.23andme.com/health/Resistance-to-HIV-AIDS/ 23andme], and possibly other direct-to-consumer genetics testing companies.

{{PharmGKB
|RSID=rs333
|Name_s=CCR5: 554_585del32; ?32; delta32
|Gene_s=CCR5
|Feature=
|Evidence=PubMed ID:10463706; PubMed ID:10839590; PubMed ID:12447757; PubMed ID:15236615; PubMed ID:16312181
|Annotation=This variant (CCR5delta32 mutation) is associated with slower HIV disease progression in untreated patients. Heterozygous carriers tend to have lower rates of virological failure than patients with the common allele, but this benefit may not extend to the long term. Most reports indicated a favorable response to antiretroviral therapy for allele carriers.
|Drugs=
|Drug Classes=
|Diseases=HIV; HIV Infections
|Curation Level=Curated
|PharmGKB Accession ID=PA162360003
}}{{PMID Auto
|PMID=15726497
|Title=Gene-environment interaction effects on the development of immune responses in the 1st year of life.
|OA=1
}}

{{PMID Auto
|PMID=17327408
|Title=Prognostic significance of host immune gene polymorphisms in follicular lymphoma survival.
|OA=1
}}

{{PMID Auto
|PMID=17355643
|Title=Frequencies of single nucleotide polymorphisms in genes regulating inflammatory responses in a community-based population.
|OA=1
}}

{{PMID Auto
|PMID=17672867
|Title=Polymorphisms in chemokine receptor genes and susceptibility to Kawasaki disease.
|OA=1
}}

{{PMID Auto
|PMID=18633131
|Title=Host immune gene polymorphisms in combination with clinical and demographic factors predict late survival in diffuse large B-cell lymphoma patients in the pre-rituximab era.
|OA=1
}}

{{PMID Auto
|PMID=18805939
|Title=Functional genetic polymorphisms and female reproductive disorders: part II--endometriosis.
|OA=1
}}

{{PMID Auto
|PMID=19066394
|Title=Organochlorine exposure, immune gene variation, and risk of non-Hodgkin lymphoma.
|OA=1
}}

{{PMID Auto
|PMID=19073967
|Title=Shared and distinct genetic variants in type 1 diabetes and celiac disease.
|OA=1
}}

{{PMID Auto
|PMID=19131662
|Title=A meta-analysis of candidate gene polymorphisms and ischemic stroke in 6 study populations: association of lymphotoxin-alpha in nonhypertensive patients.
|OA=1
}}

{{PMID Auto
|PMID=19225544
|Title=Variation in the lymphotoxin-alpha/tumor necrosis factor locus modifies risk of erythema nodosum in sarcoidosis.
|OA=1
}}

{{PMID Auto
|PMID=19263529
|Title=Genetic risk factors in recurrent venous thromboembolism: A multilocus, population-based, prospective approach.
|OA=1
}}

{{PMID Auto
|PMID=19330901
|Title=Association of 77 polymorphisms in 52 candidate genes with blood pressure progression and incident hypertension: the Women's Genome Health Study.
|OA=1
}}

{{PMID Auto
|PMID=19559392
|Title=A candidate gene association study of 77 polymorphisms in migraine.
|OA=1
}}

{{PMID Auto
|PMID=20041166
|Title=Common genetic variation and the control of HIV-1 in humans.
|OA=1
}}

{{PMID Auto
|PMID=20206716
|Title=Genetic variation within the gene encoding the HIV-1 CCR5 coreceptor in two South African populations.
|OA=1
}}

{{PMID Auto
|PMID=20552027
|Title=Host and viral genetic correlates of clinical definitions of HIV-1 disease progression.
|OA=1
}}

{{PMID Auto
|PMID=21854194
|Title=Distribution of polymorphisms in cytochrome P450 2B6, histocompatibility complex P5, chemokine coreceptor 5, and interleukin 28B genes in inhabitants from the central area of Argentina.
}}

{{PMID Auto
|PMID=22474614
|Title=Host Genes Important to HIV Replication and Evolution.
|OA=1
}}{{GET Evidence
|gene=CCR5
|aa_change=Ser185Shift
|aa_change_short=S185Shift
|impact=protective
|qualified_impact=Low clinical importance,  protective
|inheritance=recessive
|quality_scores=Array
|dbsnp_id=rs333
|overall_frequency_n=6
|overall_frequency_d=126
|overall_frequency=0.047619
|n_genomes=13
|n_genomes_annotated=0
|n_haplomes=14
|n_articles=3
|n_articles_annotated=2
|qualityscore_in_silico=3
|qualitycomment_in_silico=Y
|qualityscore_in_vitro=1
|qualitycomment_in_vitro=Y
|qualityscore_case_control=4
|qualityscore_severity=4
|qualitycomment_severity=Y
|qualityscore_treatability=4
|nblosum100=4
|autoscore=2
|webscore=N
|variant_evidence=0
|clinical_importance=2
|summary_short=Also known as CCR5-delta32, this variant is associated with resistance to many strains of HIV (but not all strains, only strains that use target the CCR5 protein). Heterozygotes are reported to have slower HIV progression, and homozygotes are very resistant to being infected by these strains.
}}
{{PMID Auto
|PMID=23632061
|Title=CCR2 and CCR5 genes polymorphisms in benign prostatic hyperplasia and prostate cancer
}}{{PMID Auto
|PMID=23107763
|Title=Host genetic risk factors for community-acquired pneumonia.
}}