{{Rsnum
|rsid=34743033
|Orientation=plus
|geno1=(C;C)
|geno2=(C;T)
|geno3=(T;T)
|Chromosome=18
|position=657646
|Gene=TYMS
|Assembly=GRCh37.p2
|GenomeBuild=37.2
|dbSNPBuild=134
|Gene_s=C18orf56,TYMS
}}response to chemotherapy http://www.pharmgkb.org/search/annotatedGene/tyms/variant.jsp

(C) more favorable therapeutic response in advanced [[colorectal cancer]] and toxicity {{PMID|10652619}} {{PMID|17716232}}

(G) allele of this SNP is associated with grade 3 to 4 neutropenia and [[diarrhea]] [[5-fluorouracil]]  Neutropenia {{PMID|16818689}}

{{PharmGKB
|RSID=rs34743033
|Name_s=TYMS:TSER 28-basepair 5'UTR enhancer region repeat (TSER*2, TSER*3)
|Gene_s=C18orf56, TYMS
|Feature=Intron, Intron
|Evidence=PubMed ID:15224082
|Annotation=Risk or phenotype-associated allele: None. Phenotype: Variants identified in a screen of 13 genes involved in the gemcitabine drug metabolic pathway. For the TYMS:TSER 28-basepair enhancer region repeat variant (TSER*2 = double repeat; TSER*3 = triple repeat), the double repeat (*2) and triple repeat (*3) alleles were found at frequency was 0.46 and 0.41 (*2), and 0.54 and 0.55 (*3) in Europeans and Africans, respectively. The following heterozygotes were also found, with varying 28-bp repeat variants in combination with the double and triple repeat variants: TSER *2/*4 (n = 1), *3/*4 (n = 3), *2/*9 (n = 4), *3/*9 (n = 5). There was no significant difference between ethnic groups in genotype frequency distribution (p > 0.05). Study size: 252. Study population/ethnicity: Healthy, unrelated blood donors of European (n = 104) and African (n = 148) descent. Significance metric(s): Not significant, p > 0.05. Type of association: GN.
|Drugs=gemcitabine
|Drug Classes=
|Diseases=
|Curation Level=Curated
|PharmGKB Accession ID=PA165110725
}}

{{PharmGKB
|RSID=rs34743033
|Name_s=TYMS: (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/3/4/7/8/9
|Gene_s=C18orf56, TYMS
|Feature=Intron, Intron
|Evidence=PubMed ID:10652619; PubMed ID:11913730; PubMed ID:12782596; PubMed ID:14522928; PubMed ID:15918040; PubMed ID:16182121; PubMed ID:17716232
|Annotation=A variable number of tandem repeat (VNTR) in the 5' UTR of TYMS. Allele with the triple repeat (3R) of VNTR has increased TYMS expression compared with those with the double repeat (2R).however, A G>C change in the second repeat of the 3R allelle makes the transcription lever similar to that of the 2R allele. Low TYMS levels are postulated to be markers of more favorable therapeutic response in advanced colorectal cancer and of higher rish of GI toxicity.
|Drugs=fluorouracil
|Drug Classes=
|Diseases=
|Curation Level=Curated
|PharmGKB Accession ID=PA161149021
}}

{{PharmGKB
|RSID=rs34743033
|Name_s=TYMS: 28 bp tandem repeat
|Gene_s=C18orf56, TYMS
|Feature=Intron, Intron
|Evidence=Web Resource:http://www.pharmgkb.org/search/annotatedGene/tyms/variant.jsp
|Annotation=A polymorphic tandem repeat in the 5'UTR of the TYMS enhancer region (TSER) resulting in from 2 (TSER*2) up to 9 (TSER*9) copies of a 28bp repeated sequence has been identified. Data suggests that increased number of repeats increase TYMS RNA and protein expression. Several studies have identified links between TSER genotype (predominantly TSER*2 and *3) and response to chemotherapy.
|Drugs=fluorouracil; methotrexate
|Drug Classes=
|Diseases=
|Curation Level=In-Depth
|PharmGKB Accession ID=PA161845841
}}

{{PharmGKB
|RSID=rs34743033
|Name_s=TYMS: 2R
|Gene_s=C18orf56, TYMS
|Feature=Intron, Intron
|Evidence=PubMed ID:16818689
|Annotation=The Gly (G) allele of this SNP is associated with grade 3 to 4 neutropenia and diarrhea and is an independent predictor of grade 3 to 4 neutropenia and diarrhea in patients with colorectal neoplasms.
|Drugs=fluorouracil
|Drug Classes=
|Diseases=Diarrhea; Neutropenia
|Curation Level=Curated
|PharmGKB Accession ID=PA162355644
}}

{{PharmGKB
|RSID=rs34743033
|Name_s=TYMS: TSER *2/*3, double (*2) and triple (*3) 28-bp tandem repeats
|Gene_s=C18orf56, TYMS
|Feature=Intron, Intron
|Evidence=PubMed ID:15677700
|Annotation=Risk or phenotype-associated allele: TYMS TSER*3/*3 > *2/*3 > *2/*2 genotypes. Phenotype: A composite pharmacogenetic index (additive from zero to five) was calculated using the following values: ATIC 347CC or TSER*3/*3 or SLC19A1 80GG or SLC19A1 80GA genotypes were valued as 0, ATIC 347CG or TSER*2/*3 or SLC19A1 80AA genotypes were valued as 1, and ATIC 347GG or TSER*2/*2 genotypes were valued as 2. The sum originating from each component (ATIC + TSER + SLC19A1) was calculated and constitutes the pharmacogenetic index for the patient. There was a significant association between smaller pharmacolgical index and greater number of tender joints (p = 0.002), swollen joints (p = 0.003), greater physician's global assessment of disease activity (p = 0.032), and higher modified Health Assessment Questionnaire (mHAQ) (p = 0.047). Study size: 226 (165 female). Study population/ethnicity: Rheumatoid arthritis patients of at least 18 years of age, recruited at 3 sites (Knoxville, TN, Albany, NY, Daytona Beach, FL) from December 2002 to November 2003, who received low dose methotrexate (MTX) treatment for at least 3 months. Significance metric(s): p < 0.05. Type of association: PD; PK; GN; FA
|Drugs=methotrexate
|Drug Classes=
|Diseases=Arthritis, Rheumatoid
|Curation Level=Curated
|PharmGKB Accession ID=PA165110754
}}
{{PMID Auto
|PMID=22825513
|Title=Association of thymidylate synthase and hypoxia inducible factor-1alpha DNA polymorphisms with pancreatic cancer
}}
{{PMID Auto
|PMID=23652803
|Title=Germline genetic variations in methotrexate candidate genes are associated with pharmacokinetics, toxicity and outcome in childhood acute lymphoblastic leukemia
}}
{{PMID Auto
|PMID=23401104
|Title=Folate-genetics and colorectal neoplasia: what we know and need to know next
}}
{{PMID Auto
|PMID=24554028
|Title=Thymidylate synthase polymorphisms are associated to therapeutic outcome of advanced non-small cell lung cancer patients treated with platinum-based chemotherapy
}}