{{Rsnum
|rsid=386834043
|Chromosome=17
|Orientation=minus
|geno1=(-;-)
|geno2=(-;CAGAAACCTGAGGCTGTCCCAATGGCATG)
|geno3=(CAGAAACCTGAGGCTGTCCCAATGGCATG;CAGAAACCTGAGGCTGTCCCAATGGCATG)
|Gene=MKS1
|position=58206554
|Gene_s=MKS1
|Assembly=GRCh38
|GenomeBuild=38.1
|dbSNPBuild=141
}}{{ClinVar
|ALT=G
|CHROM=17
|CLNACC=RCV000050029.1
|CLNALLE=1
|CLNDBN=Meckel syndrome type 1
|CLNDSDB=MedGen:OMIM:Orphanet
|CLNDSDBID=CN077329:249000:564
|CLNHGVS=NC_000017.10:g.56283915_56283943del29
|CLNSIG=5
|Disease=Meckel syndrome type 1
|FwdREF=AGAAACCTGAGGCTGTCCCAATGGCATGC
|REF=GCATGCCATTGGGACAGCCTCAGGTTTCTG
|RSPOS=56283914
|Reversed=1
|SAO=0
|SSR=0
|Tags=RV;PM;PMC;OTHERKG;LSD;OM
|VC=DIV
|VP=0x050068000000000002110200
|WGT=0
|dbSNPBuildID=137
|rsid=386834043
|GENEINFO=MKS1:54903
|GENE_ID=54903
|GENE_NAME=MKS1
}}{{PMID Auto
|PMID=16415886
|Title=MKS1, encoding a component of the flagellar apparatus basal body proteome, is mutated in Meckel syndrome.
}}

{{PMID Auto
|PMID=17377820
|Title=Molecular diagnostics of Meckel-Gruber syndrome highlights phenotypic differences between MKS1 and MKS3.
}}

{{PMID Auto
|PMID=17397051
|Title=Spectrum of MKS1 and MKS3 mutations in Meckel syndrome: a genotype-phenotype correlation. Mutation in brief #960. Online.
}}

{{PMID Auto
|PMID=17437276
|Title=Aberrant splicing is a common mutational mechanism in MKS1, a key player in Meckel-Gruber syndrome.
}}

{{PMID Auto
|PMID=17935508
|Title=A disease causing deletion of 29 base pairs in intron 15 in the MKS1 gene is highly associated with the campomelic variant of the Meckel-Gruber syndrome.
}}