{{Rsnum
|rsid = 4795541
|Gene = SLC6A4
|geno1 = (-;-)
|geno2 = (-;AGATGCTGGGGGGGCTGCAGGGGGGATGCTGGGGGTGCAGGGG)
|geno3 = (AGATGCTGGGGGGGCTGCAGGGGGGATGCTGGGGGTGCAGGGG;AGATGCTGGGGGGGCTGCAGGGGGGATGCTGGGGGTGCAGGGG)
|Orientation=plus
|Chromosome=17
|position=30237341
|Assembly=GRCh38
|GenomeBuild=38.1
|dbSNPBuild=141
|Gene_s=SLC6A4
}}This SNP represents a polymorphic region consisting of an "in/del", i.e. either an insertion or a deletion, of 43 or 44 nucleotides. This SNP is commonly known as the 5-HTTLPR variant of the serotonin transporter [[SLC6A4]] gene. The deletion allele is referred to as the "S" allele, the insertion allele is known as the "L" allele, and hence the genotypes are usually called the LL, SL, and SS genotypes in publications. Note, however, that this is actually a tri-allelic SNP, in that on occasion, a single nucleotide, usually a G, may be present at this position.

This SNP has been studied in many contexts, including the following:

* Anxiety related behaviours and disorders
* [[Depression]]
** Response to [[anti-depressant]] drugs
* Seasonality and seasonal affective disorder
* [[Suicide]]
* [[Premature ejaculation]]
** Men with the LL genotype ejaculate about twice as quickly as men with SS or SL genotypes on average, based on a study of 89 Dutch men who suffer from the primary form of premature ejaculation. [http://www.sciencedaily.com/releases/2008/10/081007132509.htm] 
* [[Attention deficit disorder]]
* [[Migraine]]
* [[Bipolar mood disorder]]
* [[Obsessive compulsive disorder]]
* [[Fibromyalgia]]
* [[Irritable bowel syndrome]]

It is beyond the current scope to summarize all the associations seen for this SNP, as well as the lack of replication reported in some follow-on studies.
{{PMID Auto
|PMID=19487392
|Title=Serotonin Transporter Gene (SLC6A4) Promoter Polymorphisms and the Susceptibility to [[Posttraumatic Stress Disorder]] in the General Population
}}

{{PharmGKB
|RSID=rs4795541
|Name_s=5-HTTLPR
|Gene_s=SLC6A4
|Feature=
|Evidence=PubMed ID:20212518
|Annotation=Risk or phenotype-associated allele: -. Phenotype: Those homozygous for the S allele of 5-HTTLPR who also experienced one or more antecedent stressful life events showed a significantly poorer response to escitalopram. Study size: 811. Study population/ethnicity: GENDEP; Europe; White; Patients with Depressive Disorder. Significance metric(s): p = 0.034. Type of association: PD.
|Drugs=escitalopram
|Drug Classes=
|Diseases=Depression; Depressive Disorder
|Curation Level=Curated
|PharmGKB Accession ID=PA165291994
}}
{{PMID Auto
|PMID=20502016
|Title=Polymorphism C in the Serotonin Transporter Gene in Depression-Free Elderly Patients with Vascular Dementia
}}

{{PharmGKB
|RSID=rs4795541
|Name_s=
|Gene_s=SLC6A4
|Feature=
|Evidence=PubMed ID:19020798
|Annotation=This in/del polymorphism (short (S)/long (L)) of the promoter region of the SLC6A4 gene was reported to influence the SLC6A4 transcription rate, with the S-allele having a two-fold reduced efficiency. This study found a significant correlation [P = 0.018, OR (95% CI): 2.1 (1.1-3.9)] between rs4795541 S-allele presence and Frontotemporal lobar degeneration susceptibility in Italians.
|Drugs=
|Drug Classes=
|Diseases=Dementia
|Curation Level=Curated
|PharmGKB Accession ID=PA164920372
}}

{{PharmGKB
|RSID=rs4795541
|Name_s=
|Gene_s=SLC6A4
|Feature=
|Evidence=PubMed ID:19272758
|Annotation=This study of 135 outpatients with major depressive disorder found no significant associations between SLC6A4 promoter region polymorphisms (5-HTTLPR and rs25531) and response rate or mean change of depressive symptoms during escitalopram treatment, but showed that patients carrying S allele of 5-HTTLPR may have increased risk for some side effects, including headache, induced by escitalopram medication.
|Drugs=escitalopram
|Drug Classes=
|Diseases=Depression
|Curation Level=Curated
|PharmGKB Accession ID=PA164920419
}}

{{PharmGKB
|RSID=rs4795541
|Name_s=SLC6A4:5HTTLPR
|Gene_s=SLC6A4
|Feature=
|Evidence=PubMed ID:19204908
|Annotation=Risk or phenotype-associated allele: l. Phenotype: The ll genotype was significantly associated with the presence of sexual dysfunction, compared with the ls and ss genotypes. This variant is an insertion/deletion in the HTR2A gene's promoter region. Study size: 115. Study population/ethnicity: Individuals taking SSRIs for at least 6 months; 92% Caucasian. Significance metric(s): OR = 2.7; p = 0.02. Type of association: CO.
|Drugs=
|Drug Classes=SELECTIVE SEROTONIN REUPTAKE INHIBITORS
|Diseases=Sexual Dysfunctions, Psychological
|Curation Level=Curated
|PharmGKB Accession ID=PA165108054
}}{{PMID Auto
|PMID=17629953
|Title=Loudness dependence of auditory evoked potentials is not associated with polymorphisms or haplotypes in the serotonin transporter gene in a community-based sample of German healthy volunteers.
}}

{{PMID Auto
|PMID=18081710
|Title=Multivariate permutation analysis associates multiple polymorphisms with subphenotypes of major depression.
|OA=1
}}

{{PMID Auto
|PMID=19721846
|Title=Candidate genes involved in neural plasticity and the risk for attention-deficit hyperactivity disorder: a meta-analysis of 8 common variants.
|OA=1
}}

{{PMID Auto
|PMID=19940176
|Title=Functional variation of the dopamine D2 receptor gene is associated with emotional control as well as brain activity and connectivity during emotion processing in humans.
|OA=1
}}
{{PMID Auto
|PMID=23728717
|Title=Common functional polymorphisms in SLC6A4 and COMT genes are associated with circadian phenotypes in a South American sample
}}